RepeatingStringOfSpecificLength.java

package strings.repeatingstringsofspecifiedlength;

import java.util.HashSet;
import java.util.Set;
import java.util.TreeSet;

/**
 * Identify all the 'n' (n will be input) letter-long sequences that occur more than once in
 * any given input string. Write a program that prints out all such sequences to the standard output stream,
 * sorted in alphabetical order.
 *
 * This question can be twisted and asked as: "Find repeating sequences of specified length in given dna
 * chromosome sequence."
 *
 * Created by techpanja
 * Created on 1/21/14 3:37 PM.
 */
public class RepeatingStringOfSpecificLength {

 public static void printRepeatingStrings(String inputString, int sequenceLength) {
 if (inputString.isEmpty() || sequenceLength <= 0 || sequenceLength >= inputString.length()) {
 System.out.println("Invalid input");
 } else {
 int i = 0;
 int j = i + sequenceLength;
 Set<String> tempSet = new HashSet<>();
 Set<String> repeatingSequences = new TreeSet<>();
 while (j <= inputString.length()) {
 if (!tempSet.add(inputString.substring(i, j))) {
 repeatingSequences.add(inputString.substring(i, j));
 }
 i++;
 j = i + sequenceLength;
 }
 for (String str : repeatingSequences) {
 System.out.println(str);
 }
 }
 }

 public static void main(String[] args) {
 printRepeatingStrings("ABABC", 2);
 printRepeatingStrings("ABABBABBZEDZEDZE", 3);
 printRepeatingStrings("AAGATCCGTCCCCCCAAGATCCGTC", 10);
 }
}