Skip to content

Repository files navigation

DEMINERS

DEMINERS (Demultiplexing and Evaluation using Machine-learning Integrated in Nanopore direct RNA Sequencing) enables clinical metagenomics and comparative transcriptomic analysis by increasing throughput and accuracy of nanopore direct RNA sequencing.

Nanopore direct RNA sequencing (DRS) advances RNA biology but is limited by relatively low basecalling accuracy, low throughput, yet high RNA input and costs.

Here we introduce a novel DRS toolkit, DEMINERS, which integrates an RNA multiplexing experimental workflow, a machine-learning barcode classifier based on Random Forest and a novel basecaller built on an optimized convolutional neural network providing an additional species-specific training module. With the increased accuracy in barcode classification and basecalling, DEMINERS can demultiplex up to 24 samples and the required RNA input and running time are both substantially reduced. We demonstrated the applications of DEMINERS in clinical metagenomics, cancer transcriptomics and parallel comparison of transcriptomic features in different biological conditions, revealing a potential role of m6A in increasing transcriptomic diversity in glioma and the mature blood-stage of malaria parasites.

Overall, DEMINERS is a simple, robust and high-throughput DRS method for accurately estimating transcript levels, poly(A) lengths, and mutation and RNA modification heterogeneity at single-read level, with minimal sequencing biases.

Contents

Overview

DEMINERS integrates three components:

  1. A multiplexing experimental workflow and the associated classifier named DecodeR utilizing a machine-learning algorithm based on Random Forest (Fig. a, b).

  2. A novel basecaller named Densecall is built on an optimized DenseNet-inspired convolutional neural network (Fig. c).

  3. The downstream data analysis for comprehensive isoform profiling, RNA variant and modification identification, and metagenomic and RNA virome analyses (Fig. d).

image1

Requirements

Hardware Requirements

Densecall and DecodeR require a standard computer with sufficient RAM to support user-defined operations. Specific hardware requirements include:

  • RAM: 2 GB minimum, 16 GB or more recommended for optimal performance.
  • CPU: 4 cores minimum, 2.3 GHz or faster per core.
  • GPU: NVIDIA 2080Ti or better (required specifically for Densecall for computational tasks).

The performance benchmarks are based on a system with 16 GB RAM, 8 cores @ 2.3 GHz each, and an internet connection speed of 25 Mbps. Model training was performed on an ASUS TS700-E9-RS8 server, equipped with 2.20 GHz Intel® Xeon® Silver 4214 CPUs, 500 GB of RAM, and an Nvidia 2080Ti GPU with 10 GB of memory.

Software Requirements

Operating Systems Supported:

  • Linux: Ubuntu 20.04 or later
  • Windows 10 or later
  • macOS: Mojave (10.14) or later

For Densecall: Ensure Python 3.7.0 or higher is installed. Install Python on Ubuntu using:

sudo apt update
sudo apt install python3
sudo apt install python3-pip

For DecodeR: Ensure R version 3.6.0 or higher is installed. Install R on Ubuntu using:

sudo echo"deb http://cran.rstudio.com/bin/linux/ubuntu xenial/"| sudo tee -a /etc/apt/sources.list
gpg --keyserver keyserver.ubuntu.com --recv-key E084DAB9
gpg -a --export E084DAB9 | sudo apt-key add -
sudo apt-get update
sudo apt-get install r-base r-base-dev

Installation

This guide provides step-by-step instructions for two installation methods:

  1. Docker Installation — for an easy, containerized setup.

​ We provide two separate Docker images on Docker Hub to ensure compatibility with ARM64 and AMD64 platforms, which you can directly extract and run.

# for ARM64 platform
docker pull lianlin/deminers:deminers-arm64
# for AMD64 platform
docker pull lianlin/deminers:deminers-amd64
docker run -it --gpus all --rm --name deminers-container lianlin/deminers
  1. Manual Installation — for installing Densecall and DecodeR manually.

1. Docker Installation

Follow the steps below to install Docker, set up NVIDIA Docker for GPU support, and run a Docker container.

Step 1: Install Docker

Run the following commands to install Docker on Ubuntu:

# Update package list and install dependencies
sudo apt-get update
sudo apt-get install -y apt-transport-https ca-certificates curl software-properties-common
# Add Docker’s official GPG key
curl -fsSL https://download.docker.com/linux/ubuntu/gpg | sudo apt-key add -
# Set up Docker’s stable repository
sudo add-apt-repository "deb [arch=amd64] https://download.docker.com/linux/ubuntu $(lsb_release -cs) stable"# Update package list again and install Docker
sudo apt-get update
sudo apt-get install -y docker-ce

Step 2: Install NVIDIA Docker (for GPU support)

To enable GPU support in Docker, follow these steps:

# Set up the distribution for NVIDIA Docker
distribution=$(. /etc/os-release;echo$ID$VERSION_ID)# Add NVIDIA's GPG key
curl -s -L https://nvidia.github.io/nvidia-docker/gpgkey | sudo apt-key add -
# Set up the NVIDIA Docker repository
curl -s -L https://nvidia.github.io/nvidia-docker/$distribution/nvidia-docker.list | sudo tee /etc/apt/sources.list.d/nvidia-docker.list
# Update package list and install NVIDIA Docker
sudo apt-get update
sudo apt-get install -y nvidia-docker2
# Restart Docker service to apply changes
sudo systemctl restart docker

Step 3: Run the Docker Container

You can now pull directly and run a Docker container with GPU support:

# Switch to the Docker group (to run Docker without sudo)
newgrp docker
# Pull the Docker image## for ARM64 platform
docker pull lianlin/deminers:deminers-arm64
## for AMD64 platform
docker pull lianlin/deminers:deminers-amd64
# Run the Docker container with GPU support
docker run -it --gpus all --rm --name deminers-container lianlin/deminers

(Optional): Build Docker Locally (if pull fails)

If you encounter a "Timeout exceeded" error while pulling the image, you can build the Docker image locally instead:

# Build the Docker image from the Dockerfile
docker build -t deminers -f Dockerfile .# Run the Docker container with GPU support
docker run -it --gpus all --rm --name deminers-container deminers

2. Manual Installation (Densecall and DecodeR)

If you prefer to install Densecall and DecodeR manually, follow these steps:

Densecall

First, set up a new environment and install the necessary Python packages using conda and pip:

# Create a new conda environment
conda create -n densecall python=3.9
conda activate densecall
# Upgrade pip
pip install --upgrade pip
# Download and install 
git clone https://github.com/LuChenLab/DEMINERS.git
cd DEMINERS/Densecall
pip install -r requirements.txt
python setup.py develop

Densecall is compatible with the basecaller of ont-bonito, allowing our trained models to be used for the basecalling process. Install ont-bonito as follows:

cd ont-bonito-0.7.3
python setup.py develop

DecodeR

Before installing DecodeR, install the necessary R packages. These packages are required for optimal functionality:

Users should install the previously mentioned packages prior to installing DecodeR, from an R terminal:

# Install necessary packages from CRANpackages<- c('changepoint', 'data.table', 'randomForest', 'smoother', 'caret')
new_packages<-packages[!(packages%in% installed.packages()[,"Package"])]
if(length(new_packages)) install.packages(new_packages)
# Install packages from Bioconductorif (!requireNamespace("BiocManager", quietly=TRUE))
install.packages("BiocManager")
BiocManager::install("rhdf5")

To install DecodeR, you have two options: either install directly from GitHub or use the compressed source file:

# Install from GitHub if remotes package is not installedif (!requireNamespace("remotes", quietly=TRUE))
install.packages("remotes")
remotes::install_github("LuChenLab/DEMINERS/DecodeR")

Alternatively, you can install DecodeR using the source file downloaded from the repository :

# Install DecodeR from a downloaded source file
R CMD INSTALL DecodeR_0.1.0.tar.gz

Tutorial

This tutorial will guide you through using DEMINERS for your RNA analysis. It is divided into four main parts: setting up your multiplexing experiment, performing base calling, demultiplexing your reads by barcode, and conducting downstream analysis.

1. Multiplexing experimental workflow

To start your multiplexing experiment, select the appropriate RTA combination from the table below based on the model that fits your experimental design. Ensure you have all the necessary RTAs before beginning your experiment.

Model_nameRTA_list
model2RTA-33,RTA-35
model4RTA-21,RTA-33,RTA-35,RTA-40
model6RTA-03,RTA-21,RTA-26,RTA-33,RTA-35,RTA-40
model8RTA-03,RTA-08,RTA-10,RTA-21,RTA-26,RTA-33,RTA-35,RTA-40
model10RTA-03,RTA-08,RTA-10,RTA-21,RTA-24,RTA-26,RTA-33,RTA-35,RTA-36,RTA-40
model12RTA-03,RTA-06,RTA-08,RTA-10,RTA-21,RTA-24,RTA-26,RTA-32,RTA-33,RTA-35,RTA-36,RTA-40
model14RTA-03,RTA-06,RTA-08,RTA-10,RTA-17,RTA-19,RTA-21,RTA-24,RTA-26,RTA-32,RTA-33,RTA-35,RTA-36,RTA-40
model16RTA-03,RTA-06,RTA-08,RTA-10,RTA-12,RTA-16,RTA-17,RTA-19,RTA-21,RTA-24,RTA-26,RTA-32,RTA-33,RTA-35,RTA-36,RTA-40
model18RTA-03,RTA-06,RTA-08,RTA-10,RTA-12,RTA-16,RTA-17,RTA-19,RTA-21,RTA-24,RTA-26,RTA-32,RTA-33,RTA-35,RTA-36,RTA-37,RTA-40,RTA-42
model20RTA-03,RTA-06,RTA-08,RTA-10,RTA-12,RTA-16,RTA-17,RTA-19,RTA-21,RTA-24,RTA-26,RTA-27,RTA-29,RTA-32,RTA-33,RTA-35,RTA-36,RTA-37,RTA-40,RTA-42
model22RTA-03,RTA-06,RTA-08,RTA-10,RTA-12,RTA-15,RTA-16,RTA-17,RTA-19,RTA-21,RTA-24,RTA-26,RTA-27,RTA-28,RTA-29,RTA-32,RTA-33,RTA-35,RTA-36,RTA-37,RTA-40,RTA-42
model24RTA-03,RTA-06,RTA-08,RTA-09,RTA-10,RTA-12,RTA-16,RTA-21,RTA-22,RTA-24,RTA-26,RTA-27,RTA-28,RTA-29,RTA-31,RTA-32,RTA-33,RTA-35,RTA-36,RTA-37,RTA-39,RTA-40,RTA-45,RTA-46

2. Split Fast5/Fastq file by barcode

Split the .fast5 or .fastq file by barcode for easier handling and analysis. The procedure involves barcode prediction, handling output formats, and the actual splitting of files.

Command-Line Usage

You can run DecodeR via command line using the following script:

git clone https://github.com/LuChenLab/DEMINERS.git
cd DEMINERS
Rscript DecodeR.R -I fast5 -M model --cores 1 -O output.tsv

The DecodeR command includes several options:

OptionDescription
-I, --fast5Path to the input .fast5 file [default = NULL]
-M, --modelPre-trained barcode prediction model. [default = NULL]. Utilize pre-trained models for barcode detection available from Pre-trained demultiplexing models.
--coresNumber of CPU cores to use for parallel processing [default = 1]
-t, --cutoffMinimum probability threshold [0-1] for classified reads (higher for accuracy, lower for recovery) [default = 0]
-l, --include.lowestInclude lowest probability reads [default = FALSE]
-O, --output_filePath and filename for output [default = NULL]
-h, --helpShow this help message and exit

Distributed R-based Workflow

Step 1: Barcode prediction

Predict the barcode using DecodeR as shown:

library(DecodeR)
# get example file from packagefast5file<- system.file("extdata/demo2_0.fast5", package="DecodeR")
# load in the model, limited by file size only the 2 barcodes model were built into the package
data("Model_2barcodes.RData")
# predict the barcode of example fast5 filepred<- DecodeR(fast5=fast5file, model=Model_2barcodes) # about 10 seconds

The DecodeR() function includes several important parameters:

ArgumentDescription
fast5Path to the input .fast5 file.
modelPre-trained barcode prediction model. Utilize pre-trained models for barcode detection available from Pre-trained demultiplexing models.
NTNumber of CPU cores to use for parallel processing.
cutoffMinimum probability threshold [0-1] for classified reads (higher for accuracy, lower for recovery).
include.lowestWhether to include the lowest probability reads in classification.
clearIf TRUE, performs a clean output.

Step 2: Handing output formats

Inspect the prediction output and histogram of probabilities:

head(pred)
# Read Barcode Probability# 1: read_0b3cabf5-44b4-4438-86df-4dfa672000e1 RTA-33 1.000# 2: read_0d11e3c0-00ca-4531-a7fc-55fc75d3bb1f RTA-33 1.000# 3: read_10cefe5e-6441-4c80-ba98-dbd50c4d6cf3 RTA-33 1.000# 4: read_12b81f83-f74f-4c45-b6b5-7e7168546ddb RTA-33 1.000# 5: read_160d5209-db4c-463c-9e1c-813e0d8e8737 RTA-35 0.994# 6: read_180def1e-e4cb-4f8b-85de-100e7fd584f9 RTA-33 0.958# histogram of predicted probability
hist(pred$Probability, xlab="Probability", main="Histogram of Probability")
# number of each barcode
table(pred$Barcode)
# RTA-33 RTA-35# 39 19

To handle reads with low prediction confidence:

# set cutoff for unclassified readpred2<- DecodeR(fast5=fast5file, model=Model_2barcodes, cutoff=0.8)
table(pred2$Barcode)
# RTA-33 RTA-35 unclassified# 37 19 2

Step 3: File splitting

Split the .fastq files using ShortRead:

BiocManager::install("ShortRead") # The Bioconductor Package ShortRead was dependent for spliting fastq file
library(ShortRead)
fq<-ShortRead::readFastq("/path/to/fastq/file/*.fastq")
R2B<- with(pred2, split(Read, Barcode))
for(iin seq_along(R2B)) {
fqi<-fq[mapply(function(x) x[1], strsplit(as.character(ShortRead::id(fq)), "")) %in% gsub("read_", "", R2B[[i]])]
ShortRead::writeFastq(object=fqi, file= paste0("/path/to/split/fastq/file", names(R2B)[i], ".fastq"))
}
File nameFile sizeDescription
fastq/RTA-33.fastq22 KBSequences that were classified as RTA-33 barcode.
fastq/RTA-35.fastq9 KBSequences that were classified as RTA-35 barcode.
fastq/unclassified.fastq1 KBSequences that could not be classified as any barcode.
Version Information

The version information about R, the OS and attached or loaded packages for this Demo analysis:

sessionInfo()
# R version 4.1.0 (2021-05-18)# Platform: x86_64-apple-darwin17.0 (64-bit)# Running under: macOS Big Sur 10.16## Matrix products: default# BLAS: /Library/Frameworks/R.framework/Versions/4.1/Resources/lib/libRblas.dylib# LAPACK: /Library/Frameworks/R.framework/Versions/4.1/Resources/lib/libRlapack.dylib## locale:# [1] zh_CN.UTF-8/zh_CN.UTF-8/zh_CN.UTF-8/C/zh_CN.UTF-8/zh_CN.UTF-8## attached base packages:# [1] stats graphics grDevices utils datasets methods base## other attached packages:# [1] DecodeR_0.1.0## loaded via a namespace (and not attached):# [1] zoo_1.8-9 compiler_4.1.0 parallel_4.1.0 rhdf5_2.36.0# [5] xts_0.12.1 curl_4.3.2 rhdf5filters_1.4.0 grid_4.1.0# [9] data.table_1.14.0 changepoint_2.2.2 TTR_0.24.2 smoother_1.1# [13] lattice_0.20-44 Rhdf5lib_1.14.2 ShortRead_1.50.0

3. Basecalling of FAST5 files

After installing Densecall, you can download pre-trained models for both general and mouse-specific applications from Pre-trained basecalling models.

Available models:

  • General model:rna_r9.4.1_hac@v1.0.tar.gz
  • Mouse-specific model:rna_mouse_r9.4.1_hac@v1.0.tar.gz

Densecall provides a method for transforming .fast5 files into .fastq format. Follow the commands below to perform basecalling:

# Activate the Densecall conda environment
conda activate densecall
# Navigate to the directory where you want to download the modelscd /path/to/DEMINERS/Densecall/densecall/models/
# Download and extract the models# Note: Ensure you have already downloaded the .tar.gz files to this directory
tar -xzvf rna_r9.4.1_hac@v1.0.tar.gz # Perform basecalling on the .fast5 files to generate .fastq files
densecall basecaller --amp --output-file basecalls.fastq \
rna_r9.4.1_hac@v1.0 /path/to/fast5_data/

The densecall basecaller command includes several options:

OptionDescription
--output-fileSpecifies the output .fastq file.
-r, --reverseReverse reads for RNA (default: True).
--seqlenSets chunk size (default: 4096).
--overlapOverlap between chunks (default: 200).
-b, --batchsizeBatch size for basecalling (default: 16).
-B, --beam-sizeBeam size for CTC beam search (default: 5).
--ampEnables Automatic Mixed Precision (AMP) for faster processing.
--max-readsLimits number of reads to basecall (default: all).

(optional) To utilize ont-bonito for base calling, execute:

bonito basecaller densecall/models/rna_r9.4.1_hac@v1.0 /data/reads \
--rna --batchsize 128 --chunksize 4096 \
--recursive --overlap 200

(optional) Training your own basecalling model

If you want to train a Densecall model using your own reads, first preprocess them using Rodan and Taiyaki. The output .hdf5 files will be used as training and validation datasets.

densecall train --config densecall/models/configs/rna_r9.4.1@v1.toml \
--data_dir /path/training/rna-train.hdf5 \
--workdir /data/training/model-dir

In addition to training a new model from scratch, you can easily fine-tune one of the pretrained models.

densecall train --config rna-config.toml \
--data_dir /path/training/rna-train.hdf5 \
--workdir /data/training/model-dir \
--checkpointfile weights_*.tar --epochs 20 \
--lr 1e-5 --retrain

The densecall train command offers these options:

OptionDescription
--configPath to the configuration file (default: rna-config.toml).
--workdirDirectory where the trained model is saved (default: model).
--data_dirDirectory with training data (train.hdf5 and valid.hdf5).
--checkpointfileCheckpoint file for model loading (default: None).
--start_epochEpoch to start fine-tuning (default: 0).
--retrainIf set, retrains the model from scratch.
--batch_sizeBatch size for training (default: 32).
--lrLearning rate (default: 0.002).
--epochsNumber of epochs (default: 30).
--train_loopcountNumber of training loops (default: 1,000,000).
--fine_tuningFine-tunes a pretrained model (default: False).
--npy_dataIf set, indicates training data is in .npy format.

All training calls use Automatic Mixed Precision to speed up training.

4. Downstream Analysis

The downstream analysis in DEMINERS focuses on three key areas after you've demultiplexed your reads:

  1. Comprehensive Isoform Characterization:

    • This step involves aligning your reads to a reference genome and correcting for splice junctions.
    • Once aligned, the reads are grouped by their splice junctions to identify isoforms at the single-read level.
    • You can detect variations like mutations, alterations in poly(A) tail length, and other modifications that contribute to different isoform signatures.
    • Use demultiplexing by Reads ID to separate the reads according to their RTA barcodes, which allows for the quantification of isoforms across multiple samples.
  2. RNA Virus Genome Construction:

    • For RNA viruses present in your samples, you can construct the viral genome from the reads. This is essential for identifying and studying new or known viruses within your sample.
  3. Metagenomic and Transcriptomic Profiling:

    • This part of the analysis is aimed at a broader view of the transcriptome and involves profiling all the genetic material in your samples.
    • It includes the identification of RNA sequences that may belong to different organisms, allowing you to understand the complexity of the RNA virome within the sample.

For detailed steps and code to perform the downstream analysis, visit the Downstream analysis codes.

Citing

A pre-print is going to be uploaded soon.

License

GNU General Public License v3.0

References

  • Sequence Modeling With CTC
  • Huang, G., Liu, Z., Van Der Maaten, L., & Weinberger, K. Q. (2017). Densely connected convolutional networks. In Proceedings of the IEEE conference on computer vision and pattern recognition (pp. 4700-4708)

Supplementary

How to build barcoded direct RNA sequencing libraries:

To build the barcoded libraries, please use the following oligonucleotide DNA sequences in place of the sequences provided with the Direct RNA Sequencing Kit (RTA). The barcode is embedded in the oligoA sequence, which will be ligated to the RNA molecule during the library preparation. The oligoA sequence contains the barcode that will be attached to the RNA molecule during library preparation. The oligoB sequence contains a barcode and poly(T), which can be used to capture poly(A)-tailed RNA. Each oligoA corresponds to an oligoB. Each oligoA matches an oligoB. The structure is shown in the figure below:

image3

RTA IDBarcode sequenceOligoA (Top sequence)OligoB (Bottom sequence)
RTA-03CCTGGTAACTGGGACACAAGACTC5'-/Phos/CCTGGTAACTGGGACACAAGACTCTAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTGAGTCTTGTGTCCCAGTTACCAGGTTTTTTTTTT-3'
RTA-06CCTCGTCGGTTCTAGGCATCGCGTATGC5'-/Phos/CCTCGTCGGTTCTAGGCATCGCGTATGCTAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTGCATACGCGATGCCTAGAACCGACGAGGTTTTTTTTTT-3'
RTA-08ACGTAACTTGGTTTGTTCCCTGAA5'-/Phos/ACGTAACTTGGTTTGTTCCCTGAATAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTTTCAGGGAACAAACCAAGTTACGTTTTTTTTTTT-3'
RTA-09CCTCCTTCAGAAGAGGGTCGCTTCTACC5'-/Phos/CCTCCTTCAGAAGAGGGTCGCTTCTACCTAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTGGTAGAAGCGACCCTCTTCTGAAGGAGGTTTTTTTTTT-3'
RTA-10GAGAGGACAAAGGTTTCAACGCTT5'-/Phos/GAGAGGACAAAGGTTTCAACGCTTTAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTAAGCGTTGAAACCTTTGTCCTCTCTTTTTTTTTT-3'
RTA-12CACACACCGACAACTTTCTT5'-/Phos/CACACACCGACAACTTTCTTTAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTAAGAAAGTTGTCGGTGTGTGTTTTTTTTTT-3'
RTA-15AACCCTCGCTGTGCCTAGTT5'-/Phos/AACCCTCGCTGTGCCTAGTTTAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTAACTAGGCACAGCGAGGGTTTTTTTTTTTT-3'
RTA-16CGAGGAGGTTCACTGGGTAG5'-/Phos/CGAGGAGGTTCACTGGGTAGTAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTCTACCCAGTGAACCTCCTCGTTTTTTTTTT-3'
RTA-17CTAACCCATCATGCAGAAGC5'-/Phos/CTAACCCATCATGCAGAAGCTAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTGCTTCTGCATGATGGGTTAGTTTTTTTTTT-3'
RTA-19TTCGGATTCTATTCCTCGTGTCTA5'-/Phos/TTCGGATTCTATTCCTCGTGTCTATAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTTAGACACGAGGAATAGAATCCGAATTTTTTTTTT-3'
RTA-21AAGCGTCTTTGTCTGAAACCTCTC5'-/Phos/AAGCGTCTTTGTCTGAAACCTCTCTAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTGAGAGGTTTCAGACAAAGACGCTTTTTTTTTTTT-3'
RTA-22AGAACCATACTCCGACTTGTGTGA5'-/Phos/AGAACCATACTCCGACTTGTGTGATAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTTCACACAAGTCGGAGTATGGTTCTTTTTTTTTTT-3'
RTA-24ACCCTCCAGAAGTACCTCTGAT5'-/Phos/ACCCTCCAGAAGTACCTCTGATTAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTATCAGAGGTACTTCTGGAGGGTTTTTTTTTTT-3'
RTA-26CATACCGACTACGCATTCTCAT5'-/Phos/CATACCGACTACGCATTCTCATTAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTATGAGAATGCGTAGTCGGTATGTTTTTTTTTT-3'
RTA-27TCAGTGAGGATCTACTTCGCCA5'-/Phos/TCAGTGAGGATCTACTTCGCCATAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTTGGCGAAGTAGATCCTCACTGATTTTTTTTTT-3'
RTA-28CTATACGAAGCTGAGGGACTGC5'-/Phos/CTATACGAAGCTGAGGGACTGCTAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTGCAGTCCCTCAGCTTCGTATAGTTTTTTTTTT-3'
RTA-29TAGTGGATGACCAAGGATAGCC5'-/Phos/TAGTGGATGACCAAGGATAGCCTAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTGGCTATCCTTGGTCATCCACTATTTTTTTTTT-3'
RTA-32GATCACAGAGATGCCTTCAGTG5'-/Phos/GATCACAGAGATGCCTTCAGTGTAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTCACTGAAGGCATCTCTGTGATCTTTTTTTTTT-3'
RTA-33CATACCTGGAACGTGGTACACCTGTA5'-/Phos/CATACCTGGAACGTGGTACACCTGTATAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTTACAGGTGTACCACGTTCCAGGTATGTTTTTTTTTT-3'
RTA-35TGGAAGATGAGACATCCTGATCTACG5'-/Phos/TGGAAGATGAGACATCCTGATCTACGTAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTCGTAGATCAGGATGTCTCATCTTCCATTTTTTTTTT-3'
RTA-36TCACTACTCACGACAGGTGGCATGAA5'-/Phos/TCACTACTCACGACAGGTGGCATGAATAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTTTCATGCCACCTGTCGTGAGTAGTGATTTTTTTTTT-3'
RTA-37GCTAGGTCAATCGATCCTTCGGAAGT5'-/Phos/GCTAGGTCAATCGATCCTTCGGAAGTTAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTACTTCCGAAGGATCGATTGACCTAGCTTTTTTTTTT-3'
RTA-40CACCCACACTTACGCTTCAGGACGTA5'-/Phos/CACCCACACTTACGCTTCAGGACGTATAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTTACGTCCTGAAGCGTAAGTGTGGGTGTTTTTTTTTT-3'
RTA-42ATGCTTGTTACATCACAGAACCCTGGAC5'-/Phos/ATGCTTGTTACATCACAGAACCCTGGACTAGTAGGTTC-3'5'-GAGGCGAGCGGTCAATTTTGTCCAGGGTTCTGTGATGTAACAAGCATTTTTTTTTTT-3'

About

No description, website, or topics provided.

Resources

Stars

4 stars

Watchers

1 watching

Forks

Releases

Packages

Used by

Contributors

Languages