BioAlign is a user-friendly tool for DNA sequence alignment, marking and visualization. It uses Clustal Omega for alignment and creates nicely formatted HTML and Word documents with sequence highlighting.
- Features
- Installation
- Usage
- Example
- Notes
- Developer Setup
- Requirements
- Troubleshooting
- Contributing
- License
- Acknowledgements
- Automatic DNA sequence alignment using Clustal Omega
- Triplet notation formatting for better readability
- Search and highlight specific DNA sequences in the alignment
- Advanced pattern matching with both exact and space-ignoring modes
- Cross-line sequence matching (finds patterns spanning multiple sequence lines)
- Output to both HTML and Word documents with highlighted matches
- Caching of alignment results for unchanged sequences
No installation required! The release zip file contains everything you need:
- Unzip the file to any location on your computer
- Run
start.batto launch the application
The package includes:
- Embedded Python 3.13.2 runtime
- Clustal Omega 1.2.2 executable
- All required Python dependencies
Create or edit the sequences.json file in the application folder. This file should contain your DNA sequences in the following format:
{
"Sequence1": "ATGCCTGACCTAGTCGATCGATGCTA",
"Sequence2": "ATGCGTGACCTAGTTGATCGATGCTA",
"Sequence3": "ATGCCTGACCAAGTCGATCTATGCTA"
}Where:
- Each key is the sequence name
- Each value is the DNA sequence
- You can add as many sequences as needed
- Double-click the
start.batfile - The program will:
- Load your sequences from sequences.json
- Perform sequence alignment (or use cached results if unchanged)
- Prompt you for search options
When prompted:
- Enter a DNA sequence to search for (e.g., "CTG") or leave empty to disable highlighting
- Choose search mode:
exact: Matches only exact sequences including spacesspaced: Ignores spaces during matching, useful for finding patterns across triplet notation
The improved spaced mode can now correctly identify patterns that span across the triplet spaces and sequence lines in the formatted output.
The program generates:
sequences.fasta: The input file for Clustal Omegasequences.aln: The alignment result from Clustal Omegasequences.html: HTML document with formatted alignment and highlightingsequences.docx: Word document with formatted alignment and highlighting
The HTML output provides a lightweight, browser-viewable alternative that doesn't require Microsoft Word to open.
For the provided example sequences, searching for "CTG" with spaced mode enabled will highlight this pattern in all sequences, allowing you to easily compare variations. The improved algorithm will now correctly find instances even when they span across the spaces in triplet notation.
- The tool caches alignment results to avoid redundant calculations
- The Word document uses Courier New font for consistent spacing
- The HTML output uses the same monospace formatting for consistency with the Word document
- The improved marking algorithm can now detect patterns that span across multiple lines of the same sequence
If you only want to work with the source code (main.py), you'll need to set up the following dependencies:
pip install biopython python-docxWindows:
- Download Clustal Omega from http://www.clustal.org/omega/
- Extract the files to a directory named
clustal-omega-1.2.2-win64in the same folder as main.py - Ensure that
clustalo.exeis directly inside this directory
macOS:
Install via Homebrew:
brew install clustal-omegaModify the path in the prepare_seq function where Clustal Omega is called to use:
command_return=subprocess.run(f"clustalo --infile {input_file_name} --outfile {output_file_name} --outfmt clustal --force", shell=True)
Linux:
Install via package manager:
sudo apt install clustal-omega(Ubuntu/Debian) or equivalentModify the path in the prepare_seq function where Clustal Omega is called to use:
command_return=subprocess.run(f"clustalo --infile {input_file_name} --outfile {output_file_name} --outfmt clustal --force", shell=True)
Create the following files in your working directory:
main.py- The main programsequences.json- Your DNA sequences in JSON formatstart.bat(optional) - For easy launching on Windows
For end users, the release package is self-contained and works on Windows systems without additional installations.
For developers working with just the source code:
- Python 3.6 or higher
- Biopython library
- python-docx library
- Clustal Omega (installed as described above)
- Access to write files in the working directory
"No module named 'Bio'"
- Make sure you've installed Biopython:
pip install biopython
- Make sure you've installed Biopython:
"No module named 'docx'"
- Make sure you've installed python-docx:
pip install python-docx
- Make sure you've installed python-docx:
"An error occurred while running clustal-omega"
- Verify that Clustal Omega is installed correctly in the expected location
- Check that you have executable permissions for the Clustal Omega binary
- Try running Clustal Omega manually to verify it works outside the application
"ModuleNotFoundError: No module named 'sequences'"
- Ensure that
sequences.jsonexists in the same directory as main.py - Check that the JSON file is properly formatted
- Ensure that
Word document has no highlighting
- Make sure you entered a valid sequence pattern that exists in your DNA sequences
- Verify you selected the appropriate search mode for your pattern
Contributions to improve BioAlign are welcome! Here's how you can contribute:
- Fork the repository
- Create a feature branch:
git checkout -b new-feature - Make your changes
- Test your changes thoroughly
- Submit a pull request with a clear description of the improvements
Please ensure your code maintains compatibility with the existing functionality and follows the project's coding style.
This project is licensed under the GNU General Public License v3.0 - see the LICENSE file for details.
- Clustal Omega for sequence alignment
- Biopython for biological sequence handling
- python-docx for Word document generation