Skip to content

Folders and files

NameName
Last commit message
Last commit date

Latest commit

History

26 Commits

Repository files navigation

BioAlign - DNA Sequence Alignment and Marking Tool

BioAlign is a user-friendly tool for DNA sequence alignment, marking and visualization. It uses Clustal Omega for alignment and creates nicely formatted HTML and Word documents with sequence highlighting.

Table of Contents

Features

  • Automatic DNA sequence alignment using Clustal Omega
  • Triplet notation formatting for better readability
  • Search and highlight specific DNA sequences in the alignment
  • Advanced pattern matching with both exact and space-ignoring modes
  • Cross-line sequence matching (finds patterns spanning multiple sequence lines)
  • Output to both HTML and Word documents with highlighted matches
  • Caching of alignment results for unchanged sequences

Installation

No installation required! The release zip file contains everything you need:

  1. Unzip the file to any location on your computer
  2. Run start.bat to launch the application

The package includes:

  • Embedded Python 3.13.2 runtime
  • Clustal Omega 1.2.2 executable
  • All required Python dependencies

Usage

Preparing Your Sequences

Create or edit the sequences.json file in the application folder. This file should contain your DNA sequences in the following format:

{
"Sequence1": "ATGCCTGACCTAGTCGATCGATGCTA",
"Sequence2": "ATGCGTGACCTAGTTGATCGATGCTA",
"Sequence3": "ATGCCTGACCAAGTCGATCTATGCTA"
}

Where:

  • Each key is the sequence name
  • Each value is the DNA sequence
  • You can add as many sequences as needed

Running the Application

  1. Double-click the start.bat file
  2. The program will:
    • Load your sequences from sequences.json
    • Perform sequence alignment (or use cached results if unchanged)
    • Prompt you for search options

Search Options

When prompted:

  1. Enter a DNA sequence to search for (e.g., "CTG") or leave empty to disable highlighting
  2. Choose search mode:
    • exact: Matches only exact sequences including spaces
    • spaced: Ignores spaces during matching, useful for finding patterns across triplet notation

The improved spaced mode can now correctly identify patterns that span across the triplet spaces and sequence lines in the formatted output.

Output

The program generates:

  • sequences.fasta: The input file for Clustal Omega
  • sequences.aln: The alignment result from Clustal Omega
  • sequences.html: HTML document with formatted alignment and highlighting
  • sequences.docx: Word document with formatted alignment and highlighting

The HTML output provides a lightweight, browser-viewable alternative that doesn't require Microsoft Word to open.

Example

For the provided example sequences, searching for "CTG" with spaced mode enabled will highlight this pattern in all sequences, allowing you to easily compare variations. The improved algorithm will now correctly find instances even when they span across the spaces in triplet notation.

Notes

  • The tool caches alignment results to avoid redundant calculations
  • The Word document uses Courier New font for consistent spacing
  • The HTML output uses the same monospace formatting for consistency with the Word document
  • The improved marking algorithm can now detect patterns that span across multiple lines of the same sequence

Developer Setup

If you only want to work with the source code (main.py), you'll need to set up the following dependencies:

Installing Python Dependencies

pip install biopython python-docx

Installing Clustal Omega

  1. Windows:

    • Download Clustal Omega from http://www.clustal.org/omega/
    • Extract the files to a directory named clustal-omega-1.2.2-win64 in the same folder as main.py
    • Ensure that clustalo.exe is directly inside this directory
  2. macOS:

    • Install via Homebrew: brew install clustal-omega

    • Modify the path in the prepare_seq function where Clustal Omega is called to use:

      command_return=subprocess.run(f"clustalo --infile {input_file_name} --outfile {output_file_name} --outfmt clustal --force", shell=True)
  3. Linux:

    • Install via package manager: sudo apt install clustal-omega (Ubuntu/Debian) or equivalent

    • Modify the path in the prepare_seq function where Clustal Omega is called to use:

      command_return=subprocess.run(f"clustalo --infile {input_file_name} --outfile {output_file_name} --outfmt clustal --force", shell=True)

Required Files Structure

Create the following files in your working directory:

  • main.py - The main program
  • sequences.json - Your DNA sequences in JSON format
  • start.bat (optional) - For easy launching on Windows

Requirements

For end users, the release package is self-contained and works on Windows systems without additional installations.

For developers working with just the source code:

  • Python 3.6 or higher
  • Biopython library
  • python-docx library
  • Clustal Omega (installed as described above)
  • Access to write files in the working directory

Troubleshooting

Common Issues

  1. "No module named 'Bio'"

    • Make sure you've installed Biopython: pip install biopython
  2. "No module named 'docx'"

    • Make sure you've installed python-docx: pip install python-docx
  3. "An error occurred while running clustal-omega"

    • Verify that Clustal Omega is installed correctly in the expected location
    • Check that you have executable permissions for the Clustal Omega binary
    • Try running Clustal Omega manually to verify it works outside the application
  4. "ModuleNotFoundError: No module named 'sequences'"

    • Ensure that sequences.json exists in the same directory as main.py
    • Check that the JSON file is properly formatted
  5. Word document has no highlighting

    • Make sure you entered a valid sequence pattern that exists in your DNA sequences
    • Verify you selected the appropriate search mode for your pattern

Contributing

Contributions to improve BioAlign are welcome! Here's how you can contribute:

  1. Fork the repository
  2. Create a feature branch: git checkout -b new-feature
  3. Make your changes
  4. Test your changes thoroughly
  5. Submit a pull request with a clear description of the improvements

Please ensure your code maintains compatibility with the existing functionality and follows the project's coding style.

License

This project is licensed under the GNU General Public License v3.0 - see the LICENSE file for details.

Acknowledgements

About

DNA sequence alignment and marking tool written in python

Topics

Resources

Stars

0 stars

Watchers

1 watching

Forks

Releases

Contributors

Languages