') + ')', 'gi'); if (regex.test(text)) { found = true; var frag = document.createDocumentFragment(); var parts = text.split(regex); parts.forEach(function(part, i) { if (i % 2 === 0) { frag.appendChild(document.createTextNode(part)); } else { var span = document.createElement('span'); span.className = 'userscript-highlight'; span.textContent = part; frag.appendChild(span); } }); node.parentNode.replaceChild(frag, node); } }); } else if (node.nodeType === 1 && node.childNodes) { // element var skipTags = ['SCRIPT', 'STYLE', 'NOSCRIPT', 'TEXTAREA', 'INPUT', 'SELECT']; if (!skipTags.includes(node.tagName)) { Array.from(node.childNodes).forEach(highlight); } } } highlight(document.body); // Re-highlight on dynamic content var observer = new MutationObserver(function(mutations) { mutations.forEach(function(m) { m.addedNodes.forEach(function(node) { if (node.nodeType === 1 || node.nodeType === 3) highlight(node); }); }); }); observer.observe(document.body, { childList: true, subtree: true }); })(); } } catch(__e) { console.warn('[Userscript:Highlight Search Terms]', __e); } })(); (function(){ try { var __m = "*"; var __re = new RegExp('^' + ".*" + ', 'i'); if (__m === '*' || __re.test(location.href)) { // Strip utm_, fbclid, gclid, etc. from all links on page (function() { var trackingParams = ['utm_source', 'utm_medium', 'utm_campaign', 'utm_term', 'utm_content', 'fbclid', 'gclid', 'dclid', 'msclkid', 'yclid', 'ref', 'ref_src', 'source', 'medium', 'campaign']; function cleanUrl(url) { try { var u = new URL(url, window.location.origin); var changed = false; trackingParams.forEach(function(p) { if (u.searchParams.has(p)) { u.searchParams.delete(p); changed = true; } }); return changed ? u.toString() : url; } catch (e) { return url; } } function cleanLinks() { document.querySelectorAll('a[href]').forEach(function(a) { var clean = cleanUrl(a.href); if (clean !== a.href) a.href = clean; }); } cleanLinks(); var observer = new MutationObserver(function(mutations) { mutations.forEach(function(m) { m.addedNodes.forEach(function(node) { if (node.nodeType === 1) { if (node.tagName === 'A') cleanLinks(); node.querySelectorAll('a[href]').forEach(function(a) { var clean = cleanUrl(a.href); if (clean !== a.href) a.href = clean; }); } }); }); }); observer.observe(document.body, { childList: true, subtree: true }); })(); } } catch(__e) { console.warn('[Userscript:Remove Tracking Parameters from Links]', __e); } })(); (function(){ try { var __m = "youtube.com"; var __re = new RegExp('^' + "youtube\\.com" + ', 'i'); if (__m === '*' || __re.test(location.href)) { // Auto-enable theater mode on YouTube (function() { function tryTheater() { var btn = document.querySelector('button[aria-label="Theater mode"], ytd-player #player button[title="Theater mode"]'); if (btn && !btn.classList.contains('activated')) { btn.click(); } } // Try immediately tryTheater(); // Try after navigation (SPA) var lastUrl = location.href; setInterval(function() { if (location.href !== lastUrl) { lastUrl = location.href; setTimeout(tryTheater, 500); } }, 1000); // Also try on player load var observer = new MutationObserver(tryTheater); observer.observe(document.body, { childList: true, subtree: true }); })(); } } catch(__e) { console.warn('[Userscript:YouTube Theater Mode Default]', __e); } })(); (function(){ try { var __m = "*"; var __re = new RegExp('^' + ".*" + ', 'i'); if (__m === '*' || __re.test(location.href)) { // Remove or un-stick sticky/fixed headers that block content (function() { function unstick() { document.querySelectorAll('header, nav, [role="banner"], .header, .navbar, .sticky, .fixed-top, [style*="position: fixed"], [style*="position:sticky"]').forEach(function(el) { if (el.style.position === 'fixed' || el.style.position === 'sticky' || getComputedStyle(el).position === 'fixed' || getComputedStyle(el).position === 'sticky') { el.style.position = 'static'; el.style.top = 'auto'; el.style.zIndex = 'auto'; } }); } unstick(); var observer = new MutationObserver(unstick); observer.observe(document.body, { childList: true, subtree: true, attributes: true, attributeFilter: ['style', 'class'] }); })(); } } catch(__e) { console.warn('[Userscript:Kill Sticky Headers]', __e); } })(); })(); GitHub - bosborne/BioPythonUtils: BioPython utilities for Sublime Text 3 · GitHub
Skip to content

Repository files navigation

BioPythonUtils

BioPython Utilities for Sublime Text 3.

Install

Install BioPythonUtils using Package Control. If you don't have Package Control see https://sublime.wbond.net.

The BioPython 1.68 code is bundled with this package, you do not need to install it.

Configure

Add your email address and BLAST defaults to your Settings file.

{
"email_for_eutils": "bio@bioteam.net",
"entrez_retmax": 1000,
"remote_blast_app": "blastp",
"remote_blast_db": "nr",
"remote_blast_format": "Text"
}

The email address is required if you want to download from NCBI using EUtils.

Commands

First select the relevant text, then run a command in the Tools -> BioPythonUtils menu.

  • "Translate"
  • "Get Sequences by Search"
  • "Get Sequences by Id"
  • "Get Sequences by Taxon"
  • "Remote BLAST"
  • "Genbank To Fasta"

"Translate"

Translates the selected text, which can be 1 or more entries in Fasta format or 1 or more entries of plain text. For example:

>2
atgctatcaatcgcgattctgcttctgctaatagcagagggctcctctcaaaattacaca
ggaaatcctgtgatatgcctggggcaccatgctgtgtccaatgggacaatggtgaaaacc
>1
atgctatcaatcacgattctgttcctgctcatagcagagggctcctctcagaattacaca
gggaatcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacc

or:

atgctatcaatcacgattctgttcctgctcatagcagagggctcctctcagaattacaca
gggaatcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacc
atgctgtcaatcacgattctgttggtgctcatagcagagggctcctctcagaattacacg
gggagtcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacg

Translation starts at the first codon and continues to the last, regardless of stop codons.

"Get Sequences by Search"

Queries NCBI Nucleotide using Entrez search service and the selected text and downloads the sequence results in GenBank format. For example:

human[ORGN] AND AKT1[GENE]

The default maximum number of records downloaded is 20, if you want more than 20 set the value in your "Settings - User" file ("entrez_retmax").

"Get Sequences by Id"

Downloads sequence from NCBI using the selected ids. Ids can be delimited by commas, returns, or space. For example:

KC781785 2

or:

2
KC781786

or:

284218, 203807

"Get Sequences by Taxon"

Downloads a taxon as GenBank format entries from NCBI using the selected NCBI Taxonomy ids. Ids can be delimited by commas, returns, or space.

"Remote BLAST"

Sends the selected Fasta format or "plain" sequence(s) to the BLAST server at NCBI and retrieves the results. You can set the application, database, and result format using the Command Palette. You can also set some default values in your "Settings - User" file ("remote_blast_app", "remote_blast_format"). Note that the available databases change depending on the BLAST application.

"Genbank To Fasta"

Creates Fasta format records from the selection, 1 or more GenBank format records.

Issues

The interaction between the plugin and various services at NCBI are synchronized, so Sublime Text is unusable while the queries ("Get Sequences*", "Remote BLAST") are running.

About

BioPython utilities for Sublime Text 3

Resources

Stars

4 stars

Watchers

2 watching

Forks

Releases

Packages

Contributors

Languages