LncDC: a machine learning based tool for long non-coding RNA detection from RNA-Seq data.
python 3 >= 3.9; pandas == 1.5; numpy == 1.23; scikit-learn == 1.1.3; xgboost == 1.7.1; imbalanced-learn == 0.9.1; biopython >= 1.79; tqdm >= 4.64
ViennaRNA (Optional, only required when using secondary structure features for prediction) Can be installed by:
- CONDA: conda install -c bioconda viennarna
- Or install from the official ViennaRNA website: https://www.tbi.univie.ac.at/RNA/
Download and install Anaconda. https://docs.anaconda.com/anaconda/install/
Create an environment
conda create -n lncdc python=3.9 Here, 'lncdc' is the name of the conda environment, which can be replaced by any names.
- Activate the environment (before we run LncDC)
conda activate lncdc
- Install ViennaRNA for secondary structure features extraction (Optional)
You can install the package by CONDA
conda install -c bioconda viennarna
Or you can install it from the official ViennaRNA website: https://www.tbi.univie.ac.at/RNA/
To confirm that ViennaRNA is properly installed, you can test it by:
python
>>> import RNA
ViennaRNA is successfully installed if there are no error messages poped up.
Download the source code from https://github.com/lim74/LncDC
Unzip the package
unzip LncDC-master.zip
- Go to LncDC-master directory
cd LncDC-master
- Install LncDC
python setup.py install
If you want to install the required side packages in a certain conda environment, make sure the environment is activated.
python test_requirements.py
python lncDC.py -i input.fa -o output -x hexamer_table.csv -m model.pkl -p imputer.pkl -s scaler.pkl -r -k ss_table -t number_of_threads
-i The inputfile with RNA sequences in fasta format. The fasta file could be regular text file or gzip compressed file (*.gz).
-o The output file that will contain the prediction results in csv format. Long noncoding RNAs are labeled as 'lncrna', and message RNAs are labeled as 'mrna'. Default: lncdc.output.csv
-x (Optional) Prebuilt hexamer table in csv format. Run lncDC-train.py to obtain the hexamer table of your own training data. Default: train_hexamer_table.csv
-m (Optional) Prebuilt training model. Run lncDC-train.py to obtain the model trained from your own training data. Default: XGB_model_SIF_PF.pkl
-p (Optional) Prebuilt imputer from training data. Run lncDC-train.py to obtain the imputer from your own training data. Default: imputer_SIF_PF.pkl
-s (Optional) Prebuilt scaler from training data. Run lncDC-train.py to obtain the imputer from your own training data. Default: scaler_SIF_PF.pkl
-r (Optional) Turn on to predict with secondary structure features. Default: turned off.
-k (Optional) Prefix of the sequence and secondary structure kmer tables. Need to specify -r first. For example, the prefix of secondary structure kmer table file 'mouse_ss_table_k1.csv' is 'mouse_ss_table'. Run lncDC-train.py to obtain the tables from your own training data. Default: train_ss_table
-t (Optional) The number of threads assigned to use. Set -1 to use all cpus. Default value: -1.
- Predict with the default model (human).
cd LncDC-master/
python bin/lncDC.py -i test/human_test_toy.fasta -o lncdc_human.csv -t 8
Here, the human_test_toy.fasta file includes human RNA sequences in fasta format. The prediction results will be stored in the file lncdc_human.csv. 8 threads are used for this prediction.
- Predict by the default human model with secondary structure features. This may take a longer time because secondary structure calculation by RNAfold (The main program of ViennaRNA) is time-consuming.
cd LncDC-master/
python bin/lncDC.py -i test/mouse_test_toy.fasta -o lncdc_mouse.csv -r -t 8
Here, the mouse_test_toy.fasta file includes mouse RNA sequences in fasta format. The prediction results will be stored in the file lncdc_mouse.csv. -r is specified so the program will perform prediction with secondary structure features added. 8 threads are used for this prediction.
- Predict with the self-trained model (without secondary structure features).
cd LncDC-master/
python bin/lncDC.py -i test/mouse_test_toy.fasta -o lncdc_mouse.csv -x data/train_hexamer_table.csv -m data/XGB_model_SIF_PF.pkl -p data/imputer_SIF_PF.pkl -s data/scaler_SIF_PF.pkl -t 8
The input file in this prediction is mouse_test_toy.fasta, which contains mouse RNA sequences in fasta format. The output file is lncdc_mouse.csv. The parameter '-x' is applied, and the hexamer table train_hexamer_table.csv is provided. '-m' is used, follewed by the self-trained model XGB_model_SIF_PF.pkl. The self-trained model only used sequence intrinsic and protein features in this case. The imputer file imputer_SIF_PF.pkl and the sclar file scaler_SIF_PF.pkl are provided with parameter '-p' and '-s', respectively. 8 threads are used for the prediction.
- Predict with the self-trained model (with secondary structure features).
cd LncDC-master/
python bin/lncDC.py -i test/mouse_test_toy.fasta -o lncdc_ss_mouse.csv -x data/train_hexamer_table.csv -m data/XGB_model_SIF_PF_SSF.pkl -p data/imputer_SIF_PF_SSF.pkl -s data/scaler_SIF_PF_SSF.pkl -r -k data/train_ss_table -t 8
The input file is mouse_test_toy.fasta and the output file is lncdc_ss_mouse.csv. In addition to the parameters requried for the prediction without using secondary structure based features, '-r' and '-k' are requried for prediction with secondary structure features. The '-r' parameter will turn on the prediction with secondary structure features, and the '-k' parameter will provide the prefix of the requried train_ss_table(s). For example, the prefix of secondary structure kmer table file 'mouse_ss_table_k1.csv' is 'mouse_ss_table'. The '-t' parameter indicates that the program will use 8 threads for prediction.
python lncDC-train.py -m mrna.fa -c cds.fa -l lncrna.fa -o output -t number_of_threads -r
-m The file with mRNA sequences in fasta format. The fasta file could be regular text file or gzip compressed file (*.gz). -c The CDS sequences of the mRNAs in fasta format. The fasta file could be regular text file or gzip compressed file (*.gz). The order and number of the CDS sequences should be the same as the mRNA sequences.
-l The file with lncRNA sequences in fasta format. The fasta file could be regular text file or gzip compressed file (*.gz).
-o The prefix of the output files, including a hexamer table, a prediction model, an imputer and a scaler. If the '-r' parameter turned on, the output files will also include secondary structure kmer tables.
-t (Optional) The number of threads assigned to use. Set -1 to use all cpus. Default value: -1.
-r (Optional) Turn on to train a model with secondary structure features. This will generate secondary structure kmer tables. Default: turned off.
FASTA format example:
>id or name for transcript 1
AGGGCCAACGAACGCAACACAGGGACATGGGGGACAGAGAGGAATGTCTCTCTACCCCCCAACC
CCCCATGTCTGTGGTGAAGTCGATCGAATTAGTGCTGCCCGAGGATAGAATCTACCTGGGGACC
CCATACTGGCTCCAGCATAAAGGGCAGGTGATCTTAACCCTGAACA
>id or name for transcript 2
AACAGCACCCTGGTGGACCCCATAAGGGCCAACGAACCGGGAATTCCCCCCAACCCCCCATGTC
CGAATTAGTGCTGCCCGAGGATAGAATCTACCTGGCTGGCTCCAGCATAAAGGGCAGGTGATCT
AAGAATTGCAACAAC
NOTE: Suppose you use LncDC to predict lncRNAs from non-model organisms and don't have enough well-annotated lncRNAs for model training. In that case, you could train a model with the data from evolutionary closed model organisms, such as Zebrafish, Yeast, Soybean, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Oryza sativa, and etc.
- Train a model (No secondary structure features) using mouse data
cd LncDC-master/
python bin/lncDC-train.py -m mrna_mouse.fasta -c cds_mouse.fasta -l lncrna_mouse.fasta -o self_mouse -t 8
To train a model with mouse data, we need to provide the mRNA and lncRNA sequences, respectively. The mRNA sequences are stored in the mrna_mouse.fasta file, and their corresponding CDS sequences are stored in the cds_mouse.fasta file. The lncrna_mouse.fasta file includes the long noncoding RNA sequences. 'self_mouse' is the prefix of the output files, which include four files: self_mouse_hexamer_table.csv, self_mouse_xgb_model_SIF_PF.pkl, self_mouse_imputer_SIF_PF.pkl and self_mouse_scaler_SIF_PF.pkl. We set '-t' to 8 so that there are 8 threads will be used for the model training.
- Train a model (with secondary structure features) using mouse data. This may take a longer time because secondary structure calculation by RNAfold (The main program of ViennaRNA) is time-consuming.
cd LncDC-master/
python bin/lncDC-train.py -m mrna_mouse.fasta -c cds_mouse.fasta -l lncrna_mouse.fasta -o SS_mouse -r -t 8
To train a model with secondary structure features, we only need to add the '-r' parameter. In addition to the outputs with a prefix 'SS_mouse' that are similar to the first example, five ss tables will also be generated, including SS_mouse_ss_table_k1.csv, SS_mouse_ss_table_k2.csv, SS_mouse_ss_table_k3.csv, SS_mouse_ss_table_k4.csv and SS_mouse_ss_table_k5.csv.
Minghua Li
Li, M., Liang, C. LncDC: a machine learning-based tool for long non-coding RNA detection from RNA-Seq data. Sci Rep 12, 19083 (2022). https://doi.org/10.1038/s41598-022-22082-7
This project is licensed under the MIT License. Copyright (c) 2020 lim74