Bioinformatician & molecular biotechnologist. Python & pun lover.
AACGAAGTGGAACGCGGCCAGAACAACGCGGGCATTGTGGAATATCAGGTGGTGCCG
- Proxima
- Hamburg, Germany
- www.linkedin.com/in/patrick-kunzmann
- https://orcid.org/0000-0002-9756-0914
Pinned Loading
- biotite
biotite PublicForked from biotite-dev/biotite
A comprehensive library for computational molecular biology
- gecos
gecos PublicForked from biotite-dev/gecos
Generated color schemes for sequence alignment visualizations
Python
Something went wrong, please refresh the page to try again.
If the problem persists, check the GitHub status page or contact support.
If the problem persists, check the GitHub status page or contact support.
Uh oh!
There was an error while loading. Please reload this page.






